Opri
Encyclopedia : O : OP : OPR : Opri
Opri - A Finnish girl's name that is derived from Greek and means happy or felicity. The name is not much used today but was more popular forty years ago.
The name is most famously connected with a film character. Opri. FI 1954. PC: Suomen Filmiteollisuus. P: T.J. Särkkä. D: Edvin Laine. SC: Olavi Veistäjä - based on the play by Kyllikki Mäntylä (1953). DP: Pentti Unho. AD: Karl Fager. M: Heikki Aaltoila. S: Kaarlo Nissilä. ED: Armas Vallasvuo. Starring Rakel Laakso (Opri), Elsa Turakainen (Akviliina), Elna Hellman (Miina), Liisa Pakarinen (Tiina), Ossi Kostia (Otto Arolin), Eero Roine (Alpertti), Sylvi Salonen (the Head of the Seniors' Home), Marjatta Kallio (Heinäsirkka, the nurse), Kosti Klemelä (Jussi the farmhand). 78 min. A vintage print with signs of wear but a good definition. Viewed at Orion, Helsinki, 21 Sep 2005. The magnificent interpretation of Rakel Laakso carries the picture and makes it worthwhile. Such a portrait probably will be called immortal in the future. It takes place at a senior people's home where Opri becomes the light of the inhabitants' lives. She is a seer, a dreamer who compares herself to Joseph, maybe a (white) witch. Rakel Laakso knows what she's doing but the film has been put together in a hurry. Laine keeps missing points and sinks too often into the lowbrow. The epic aspect is promising with montages of lost Karelia, the challenge of after-war reconstruction, and daily work. Besides Opri another bright character is Marjatta Kallio's nurse; also Sylvi Salonen is fine as the mistress of the house. But there is too much that is contrived and repetitive here despite the short duration.
There is also a gene called OprI with the nucliotide sequence ATGAACAACGTTCTGAAATTCTCTGCTCTGGCTCTGGCTGCTGTTCTGGCCACCGGTTGCAGCAGCCACTCCAAAGAAACCGAAGCTCGTCTGACCGCTACCGAAGACGCAGCTGCTCGTGCTCAGGCTCGCGCTGACGAAGCCTATCGCAAGGCTGACGAAGCTCTGGGCGCTGCTCAGAAAGCTCAGCAGACTGCTGACGAGGCTAACGAGCGTGCCCTGCGCATGCTGGAAAAAGCCAGCCGCAAGTAA
From Wikipedia, the Free Encyclopedia. Original article here. Support Wikipedia by contributing or donating.
All text is available under the terms of the GNU Free Documentation License See Wikipedia Copyrights for details.
